crispr guide Search Results


94
PackGene Biotech lnc ssaav u6 sgrna efs zsgreen plasmid
Ssaav U6 Sgrna Efs Zsgreen Plasmid, supplied by PackGene Biotech lnc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc12259261-185-8-12?v=PackGene+Biotech+lnc
Average 94 stars, based on 1 article reviews
ssaav u6 sgrna efs zsgreen plasmid - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

92
Danaher Inc alt rtm crispr guide rnas
Alt Rtm Crispr Guide Rnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/bio_rxiv__2020__10__05__317925-593-11-16?v=Danaher+Inc
Average 92 stars, based on 1 article reviews
alt rtm crispr guide rnas - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

93
OriGene interspaced short palindromic repeats crispr associated protein 9 single guide rna
Interspaced Short Palindromic Repeats Crispr Associated Protein 9 Single Guide Rna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/us12479807-263-31-42?v=OriGene
Average 93 stars, based on 1 article reviews
interspaced short palindromic repeats crispr associated protein 9 single guide rna - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Addgene inc crispr guide
Crispr Guide, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc06575637__pnas__1819825116__sapp-71-34-36?v=Addgene+inc
Average 86 stars, based on 1 article reviews
crispr guide - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
GenScript corporation aldh2 crispr guide rna cccgctcgatcagatcggcc
Aldh2 Crispr Guide Rna Cccgctcgatcagatcggcc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pm40558540-73-0-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
aldh2 crispr guide rna cccgctcgatcagatcggcc - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation dpp4 protein
Generation of soluble recombinant human ACE2-Fc and <t>DPP4-Fc</t> protein as decoy receptors to SARS-CoV-2 and MERS-CoV, respectively. Recombinant human ACE2-Fc and DPP4-Fc proteins were generated by fusing the C terminus of the human ACE2 and DPP4 extracellular domains to a human IgG Fc domain as coronaviruses inhibitors.
Dpp4 Protein, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc10873275-63-9-23?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
dpp4 protein - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Broad Institute Inc crispri sgrna guides
A dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e., sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce <t>sgRNA</t> expression. Cells were then left untreated (UT), or treated with 20 μg/ml DMXAA or 10 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. B, C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml Dox to induce sgRNA expression. Cells were then left UT, or treated with 20 μg/ml DMXAA or 5 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cell supernatant was collected and assayed for secreted IFNβ (B) and IL6 (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where * P < 0.05, *** P < 0.001, **** P < 0.0001. n.d., not detected. D–F dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e. 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Ifnb1 (D), Isg15 (E) and Irf7 (F) was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Tukey's multiple comparisons test, where * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Bars display significant differences between dCas9 and sgRNA knockdowns in the absence of H‐151. Additional asterisks represent significant differences between the absence or presence of H‐151 across the same cell line. Source data are available online for this figure.
Crispri Sgrna Guides, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc10267698-223-24-31?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
crispri sgrna guides - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)
A dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e., sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce <t>sgRNA</t> expression. Cells were then left untreated (UT), or treated with 20 μg/ml DMXAA or 10 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. B, C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml Dox to induce sgRNA expression. Cells were then left UT, or treated with 20 μg/ml DMXAA or 5 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cell supernatant was collected and assayed for secreted IFNβ (B) and IL6 (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where * P < 0.05, *** P < 0.001, **** P < 0.0001. n.d., not detected. D–F dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e. 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Ifnb1 (D), Isg15 (E) and Irf7 (F) was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Tukey's multiple comparisons test, where * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Bars display significant differences between dCas9 and sgRNA knockdowns in the absence of H‐151. Additional asterisks represent significant differences between the absence or presence of H‐151 across the same cell line. Source data are available online for this figure.
Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/10__1074_slash_jbc__ra118__006693-184-10-28?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Broad Institute Inc ap2a2 crispr guide sgrna 2
(A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
Ap2a2 Crispr Guide Sgrna 2, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc06007032-57-0-8?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
ap2a2 crispr guide sgrna 2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
(A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pm38307859-283-32-48?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3)
(A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
Hrh1 Targeting Single Guide Rna (Sghrh1; 5’ Cgatcaagtccgccaccgag 3), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc09895059-208-13-26?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
hrh1-targeting single guide rna (sghrh1; 5’-cgatcaagtccgccaccgag-3) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
ToolGen Incorporated crispr guide rnas
(A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and <t>Ap2a2-HA</t> tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.
Crispr Guide Rnas, supplied by ToolGen Incorporated, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+guide/pmc09098221-380-6-18?v=ToolGen+Incorporated
Average 90 stars, based on 1 article reviews
crispr guide rnas - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


Generation of soluble recombinant human ACE2-Fc and DPP4-Fc protein as decoy receptors to SARS-CoV-2 and MERS-CoV, respectively. Recombinant human ACE2-Fc and DPP4-Fc proteins were generated by fusing the C terminus of the human ACE2 and DPP4 extracellular domains to a human IgG Fc domain as coronaviruses inhibitors.

Journal: Antibody Therapeutics

Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks

doi: 10.1093/abt/tbad030

Figure Lengend Snippet: Generation of soluble recombinant human ACE2-Fc and DPP4-Fc protein as decoy receptors to SARS-CoV-2 and MERS-CoV, respectively. Recombinant human ACE2-Fc and DPP4-Fc proteins were generated by fusing the C terminus of the human ACE2 and DPP4 extracellular domains to a human IgG Fc domain as coronaviruses inhibitors.

Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD, DPP4, M336 and ab1 were synthesized and codon-optimized for expression in CHO cells by Genscript (China).

Techniques: Recombinant, Generated

Purified recombinant WT ACE2-Fc, Modified ACE2-Fc, DPP4-Fc, Beta RBD-Fc, IgG ab1-IgG and M336-IgG. (A) The stained SDS-PAGE gel under reducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~100 kDa, Beta RBD-Fc at ~ 60 kDa, and IgGs light chain at ~25 kDa and heavy chain at ~50 kDa. (B) Stained gel under nonreducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~200 kDa, Beta RBD-Fc at ~120 kDa and IgGs at ~ 150 kDa. (C) Western blot stained with anti-human IgG-HRP polyclonal antibody confirmed that Fc-fusion proteins and IgGs mAbs were efficiently expressed and purified. (D) ELISA for anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs. ELISA plate was coated with 1 μg/mL recombinant SARS-CoV-S and MERS-CoV-S proteins, then probed with 3 μg/mL of the anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs mAbs. Binding was detected using HRP-conjugated anti-human IgG polyclonal antibody. Error bars represent standard deviations.

Journal: Antibody Therapeutics

Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks

doi: 10.1093/abt/tbad030

Figure Lengend Snippet: Purified recombinant WT ACE2-Fc, Modified ACE2-Fc, DPP4-Fc, Beta RBD-Fc, IgG ab1-IgG and M336-IgG. (A) The stained SDS-PAGE gel under reducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~100 kDa, Beta RBD-Fc at ~ 60 kDa, and IgGs light chain at ~25 kDa and heavy chain at ~50 kDa. (B) Stained gel under nonreducing conditions shows WT ACE2-Fc, Modified ACE2-Fc and DPP4-Fc at ~200 kDa, Beta RBD-Fc at ~120 kDa and IgGs at ~ 150 kDa. (C) Western blot stained with anti-human IgG-HRP polyclonal antibody confirmed that Fc-fusion proteins and IgGs mAbs were efficiently expressed and purified. (D) ELISA for anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs. ELISA plate was coated with 1 μg/mL recombinant SARS-CoV-S and MERS-CoV-S proteins, then probed with 3 μg/mL of the anti-SARS-CoV-2 and anti-MERS-CoV Fc-fusion proteins and IgGs mAbs. Binding was detected using HRP-conjugated anti-human IgG polyclonal antibody. Error bars represent standard deviations.

Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD, DPP4, M336 and ab1 were synthesized and codon-optimized for expression in CHO cells by Genscript (China).

Techniques: Purification, Recombinant, Modification, Staining, SDS Page, Western Blot, Enzyme-linked Immunosorbent Assay, Binding Assay

A schematic illustration of the MERS-CoV RBD sequences in humans (A) and camels (B). The representation shows the DPP4 and M336-IgG epitopes as well as the pseudovirus variants that are included in this report. Variants found from the multiple sequence alignment of the RBD sequences with their number of occurrences indicated at the top of the residues.

Journal: Antibody Therapeutics

Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks

doi: 10.1093/abt/tbad030

Figure Lengend Snippet: A schematic illustration of the MERS-CoV RBD sequences in humans (A) and camels (B). The representation shows the DPP4 and M336-IgG epitopes as well as the pseudovirus variants that are included in this report. Variants found from the multiple sequence alignment of the RBD sequences with their number of occurrences indicated at the top of the residues.

Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD, DPP4, M336 and ab1 were synthesized and codon-optimized for expression in CHO cells by Genscript (China).

Techniques: Sequencing

Neutralization of MERS-CoV pseudotyped virus using receptor trap and mAb. The inhibitory effect of varying concentrations of DPP4-Fc and M336-IgG was tested against MERS-CoV pseudovirus. IC 50 values of DPP4-Fc and M336-IgG are shown. Data are shown as the mean ± SD of duplicates. Dotted lines represent cutoffs of the assays.

Journal: Antibody Therapeutics

Article Title: ACE2-Fc and DPP4-Fc decoy receptors against SARS-CoV-2 and MERS-CoV variants: a quick therapeutic option for current and future coronaviruses outbreaks

doi: 10.1093/abt/tbad030

Figure Lengend Snippet: Neutralization of MERS-CoV pseudotyped virus using receptor trap and mAb. The inhibitory effect of varying concentrations of DPP4-Fc and M336-IgG was tested against MERS-CoV pseudovirus. IC 50 values of DPP4-Fc and M336-IgG are shown. Data are shown as the mean ± SD of duplicates. Dotted lines represent cutoffs of the assays.

Article Snippet: The sequence of Wild-type(WT) ACE2, Modified ACE2, Beta RBD, DPP4, M336 and ab1 were synthesized and codon-optimized for expression in CHO cells by Genscript (China).

Techniques: Neutralization, Virus

A dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e., sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 20 μg/ml DMXAA or 10 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. B, C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml Dox to induce sgRNA expression. Cells were then left UT, or treated with 20 μg/ml DMXAA or 5 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cell supernatant was collected and assayed for secreted IFNβ (B) and IL6 (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where * P < 0.05, *** P < 0.001, **** P < 0.0001. n.d., not detected. D–F dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e. 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Ifnb1 (D), Isg15 (E) and Irf7 (F) was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Tukey's multiple comparisons test, where * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Bars display significant differences between dCas9 and sgRNA knockdowns in the absence of H‐151. Additional asterisks represent significant differences between the absence or presence of H‐151 across the same cell line. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: Termination of STING responses is mediated via ESCRT ‐dependent degradation

doi: 10.15252/embj.2022112712

Figure Lengend Snippet: A dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e., sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 20 μg/ml DMXAA or 10 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. B, C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml Dox to induce sgRNA expression. Cells were then left UT, or treated with 20 μg/ml DMXAA or 5 μg/ml 2′3′‐cGAM(PS)2 for 6 h. Cell supernatant was collected and assayed for secreted IFNβ (B) and IL6 (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where * P < 0.05, *** P < 0.001, **** P < 0.0001. n.d., not detected. D–F dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e. 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Ifnb1 (D), Isg15 (E) and Irf7 (F) was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Tukey's multiple comparisons test, where * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. Bars display significant differences between dCas9 and sgRNA knockdowns in the absence of H‐151. Additional asterisks represent significant differences between the absence or presence of H‐151 across the same cell line. Source data are available online for this figure.

Article Snippet: Third‐generation lentiviral transduction (see below) was used to generate iBMDMs expressing blasticidin‐selectable dCas9‐KRAB, which were selected with 5 μg/ml blasticidin for ~ 72 h. CRISPRi sgRNA guides were designed using the Broad Institute CRISPick online tool ( https://portals.broadinstitute.org/gppx/crispick/public ) and cloned into the doxycycline‐inducible sgRNA plasmid pFgH1tUT, expressing GFP (see below).

Techniques: Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Incubation, Purification

A–C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 500 ng/ml LPS or 200 ng/ml Pam3CSK4 (P3C) for 6 h. A Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. (B, C) Cell supernatant was collected and assayed for secreted IL‐6 (B) or TNF (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statically significant differences were observed across cell lines for the same treatment. D dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e., 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Il6 was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statistically significant changes were observed. E VPS4a WT or VPS4a E228Q dominant negative BMDMs were left UT or treated with 1 μg/ml Dox for 4 h. iBMDMs were then further left UT or treated with 10 μg/ml 2′3′‐cGAM(PS)2 for 4 h. Cell supernatant was collected and secreted IL‐6 was measured by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using one‐way ANOVA using Bonferroni's multiple comparisons test, where ** P < 0.01, *** P < 0.001. n.d., not detected. Source data are available online for this figure.

Journal: The EMBO Journal

Article Title: Termination of STING responses is mediated via ESCRT ‐dependent degradation

doi: 10.15252/embj.2022112712

Figure Lengend Snippet: A–C dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 48 h with 1 μg/ml doxycycline (Dox) to induce sgRNA expression. Cells were then left untreated (UT), or treated with 500 ng/ml LPS or 200 ng/ml Pam3CSK4 (P3C) for 6 h. A Cells were lysed for immunoblot with the indicated antibodies. Data shown are representative of three independent experiments. (B, C) Cell supernatant was collected and assayed for secreted IL‐6 (B) or TNF (C) by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statically significant differences were observed across cell lines for the same treatment. D dCas9‐KRAB expressing iBMDMs, without (i.e. dCas9 alone) or with HRS‐targeting sgRNAs (i.e. sg1, sg2 or sg3) were treated for 24 h with 1 μg/ml Dox to induce sgRNA expression. iBMDMs were further treated with 1 μg/ml (i.e., 1,000 ng/ml) or 100 ng/ml H‐151 as indicated and incubated for a further 24 h. Cells were lysed for RNA purification and the expression of Il6 was analysed by qPCR. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using two‐way ANOVA using Bonferroni's multiple comparisons test, where no statistically significant changes were observed. E VPS4a WT or VPS4a E228Q dominant negative BMDMs were left UT or treated with 1 μg/ml Dox for 4 h. iBMDMs were then further left UT or treated with 10 μg/ml 2′3′‐cGAM(PS)2 for 4 h. Cell supernatant was collected and secreted IL‐6 was measured by ELISA. Data are shown as mean ± SEM combined from N = 3 independent experiments. Statistical analysis was performed using one‐way ANOVA using Bonferroni's multiple comparisons test, where ** P < 0.01, *** P < 0.001. n.d., not detected. Source data are available online for this figure.

Article Snippet: Third‐generation lentiviral transduction (see below) was used to generate iBMDMs expressing blasticidin‐selectable dCas9‐KRAB, which were selected with 5 μg/ml blasticidin for ~ 72 h. CRISPRi sgRNA guides were designed using the Broad Institute CRISPick online tool ( https://portals.broadinstitute.org/gppx/crispick/public ) and cloned into the doxycycline‐inducible sgRNA plasmid pFgH1tUT, expressing GFP (see below).

Techniques: Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Incubation, Purification, Dominant Negative Mutation

(A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) Schematic diagrams of different baits (LLO truncations) constructs tested in the yeast 2-hybrid assay. (B) Quantification of secreted alpha-galactosidase activity following a GAL4-based two-hybrid interaction in Y2HGold yeast colonies. The results represented the percentage of alpha-galactosidase activity of positive control (p53+ SV40 large T antigen). Bars and error represent mean ± SD of replicate measurements. N=4 biological repeats *** p<0.001 (Student’s t-test). Results shown represent at least 3 independent experiments. (C) HEK 293T and HeLa cells were co-transfected with LLO-Myc tag and Ap2a2-HA tag plasmids. At 24 hours post transfection, cells were permeabilized and stained with anti-Myc (red), anti-HA antibodies (Green), and nuclear dye DAPI (blue). Scale bars are 10 μm. (B) Co-immunoprecipitation of Ap2a2 from transfected HEK293T cells using an anti-Myc-LLO antibody. Results shown represent 3 independent experiments. See also Figure S3.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Construct, Y2H Assay, Activity Assay, Positive Control, Transfection, Staining, Immunoprecipitation

(A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: (A) The intracellular growth of the wild type 10403S strain and the L. monocytogenes-LLO L461T strain in BMMs with the CRISPR/Cas9-mediated Ap2a2 knockout and sgRNA control BMMs. 50μg/ml gentamicin was added after 1h to kill extracellular bacteria. Results shown represent at least 3 independent experiments. (B) Schematic of hlyfl L. monocytogenes strain. The hly and tetL (tetracycline resistance) genes are flanked by loxP sites. Cre recombinase is expressed from the cytosol-specific actA promoter. Recombination between loxP sites leads to the excision of the DNA encoding hly and tetL. (C) Intracellular growth of the hlyfl L. monocytogenes strain in Ap2a2 knockout and control BMMs. 50μg/ml gentamicin was added to kill extracellular L. monocytogenes. Results are representative of at least 3 independent experiments. (D) Flow cytometry analysis of SYTOX Blue staining of control and Ap2a2 knockdown BMM infected for 8 hours with an effective MOI of 1. Positively stained cells resulted from the loss of plasma membrane integrity. No gentamicin was added for plasma membrane integrity assay. ** p<0.01, *** p<0.001 (Student’s t-test). Results shown represent 2 independent experiments. See also Figure S4.

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: CRISPR, Knock-Out, Control, Bacteria, Flow Cytometry, Staining, Knockdown, Infection, Clinical Proteomics, Membrane, Integrity Assay

KEY RESOURCES TABLE

Journal: Cell host & microbe

Article Title: The Listeriolysin O PEST-like Sequence Co-opts AP-2-Mediated Endocytosis to Prevent Plasma Membrane Damage during Listeria Infection

doi: 10.1016/j.chom.2018.05.006

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Ap2a2 CRISPR guide sgRNA 2 , TCACCTGACCTAGTTCCCAT , Broad institute GPP Web Portal https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design.

Techniques: Virus, Recombinant, Staining, Flow Cytometry, Modification, Lysis, Transfection, Immunoprecipitation, Plasmid Preparation, CRISPR, Software, Microscopy